Metadata
| Filename | GM24385_1.fastq.gz |
| Filesize | 27.16 GiB |
| Sequali version | 1.0.1 |
Summary
| Mean length | 9,115.18 | |
| Length range (min-max) | 3 | 497,187 |
| Total reads | 2,900,987 | |
| Q20 reads | 0 | 0.00% |
| Total bases | 26,443,022,791 | |
| Total GC bases | 10,703,095,094 | 40.48% |
| Q20 bases | 14,645,135,876 | 55.38% |
Sequence length distribution
See this wikipedia lemma for an explanation about contiguity statistics.
| Percentile | Read length |
|---|---|
| 1 | 18 |
| 5 | 28 |
| 10 | 35 |
| 25 | 54 |
| 50 | 1,039 |
| 75 | 6,442 |
| 90 | 27,121 |
| 95 | 53,491 |
| 99 | 106,963 |
| Contiguity | Read length |
|---|---|
| N90 | 6,888 |
| N50 | 50,349 |
Per position quality score distribution
Per position quality percentiles (approximation)
Shows the mean for all bases and the means of the lowest and highest percentiles to indicate the spread. Since the graph is based on the binned phreds, rather than exact phreds, it is an approximation.
Per sequence average quality scores
| >=Q5 | 1,403,578 | 48.38% |
| >=Q7 | 1,199,332 | 41.34% |
| >=Q10 | 757,656 | 26.12% |
| >=Q12 | 210,743 | 7.26% |
| >=Q15 | 28 | 0.00% |
| >=Q20 | 0 | 0.00% |
| >=Q30 | 0 | 0.00% |
Per position base content
Per position N content
Per sequence GC content
For short reads with fixed size (i.e. Illumina) the plot will look very spiky due to the GC content calculation: GC bases / all bases. For read lengths of 151, both 75 and 76 GC bases lead to a percentage of 50% (rounded) and 72 and 73 GC bases leads to 48% (rounded). Only 74 GC bases leads to 49%. As a result the even categories will be twice as high, which creates a spike. The smoothened plot is provided to give a clearer picture in this case.
Adapter content
Only adapters that are present more than 0.1% are shown. Given the 12 bp length of the sequences used to estimate the content, values below this threshold are problably false positives. The legend is sorted from most frequent to least frequent.
For nanopore the adapter mix (AMX) and ligation kit have overlapping adapter sequences and are therefore indistinguishable. Please consult the nanopore documentation for more information which adapters are used by your kit.
For illumina short reads, the last part of the graph will be flat as the 12 bp probes cannot be found in the last 11 base pairs.
Adapter counts are accumulated towards the start for front (5') adapters and towards the end for end (3') adapters.
For the reads start and end plots, only adapters found in the first and last 100 bp are shown. All adapter counts are accumulated towards the start and end respectively.
Per tile quality
Per tile quality skipped. Reason: Can not parse header: '35eb0273-89e2-4093-98ed-d81cbdafcac7 runid=1d18d9e9682449156d70520e06571f01c4e6d2d8 sampleid=GM24185_1 read=41492 ch=2628 start_time=2019-01-26T18:52:46Z'.Duplication percentages
Fingerprints are taken by taking a sample from the beginning and the end at an offset. The samples are combined and hashed while using the length as a seed. A subsample of these fingerprints is stored to estimate the duplication rate. See the documentation for a complete explanation.
| Fingerprint front sequence length | 8 |
| Fingerprint front sequence offset | 64 |
| Fingerprint back sequence length | 8 |
| Fingerprint back sequence offset | 0 |
| Subsampled fingerprints | 533,044 |
| Estimated remaining sequences if deduplicated | 72.71% |
Overrepresented sequences
A subsample of the sequences is analysed Sequences are cut into fragments of up to 31 bp. Fragments are stored and counted. When the maximum amount of unique fragments is reached, only fragments that are already stored are counted. The rest of the fragments is ignored. Fragments are stored in their canonical representation. That is either the sequence or the reverse complement, whichever has the lowest sort order. Both representations are shown in the table. See the documentation for a complete explanation. The sequence identity is calculated by .
The percentage shown is an estimate based on the number of occurences of the fragment in relation to the number of sampled sequences. Fragments are only counted once per sequence. Fragments that occur more than once in a sequence are counted as one.
| Total sequences in file | 2,900,987 |
| Sampled sequences | 362,624 |
| Sampling rate | 1 in 8 |
| Total fragments sampled | 2,600,688 |
| Stored unique fragments | 2,281,869 |
| Maximum unique fragments | 5,000,000 |
| Fragment size | 21 |
| count | percentage | canonical sequence | reverse complemented sequence | sequence identity | best match |
|---|---|---|---|---|---|
| 10768 | 2.97% | GTAACTGAACGAAGTACAACA | TGTTGTACTTCGTTCAGTTAC | 85.71% | Oxford nanopore Native Adapter (NA), bottom strand |
| 7524 | 2.07% | CTCCTCCTCCTCCTCCTCCTC | GAGGAGGAGGAGGAGGAGGAG | 71.43% | gnl|uv|M97937.1:846-1007 Plasmid pGEX-5G/LIC expression vector(E. coli/S. japonicium) encoding glutathione S-transferase gene, complete cds |
| 4976 | 1.37% | TAACTGAACGAAGTACAATGA | TCATTGTACTTCGTTCAGTTA | 90.48% | gnl|uv|NGB01107.1:1-36 Oxford Nanopore Technologies Ligation Sequencing Kit (SQK-LSK114) Ligation Adaptor Y Top |
| 3122 | 0.86% | GGAGGAGGAGGAGGAGGAGGA | TCCTCCTCCTCCTCCTCCTCC | 71.43% | gnl|uv|M97937.1:846-1007 Plasmid pGEX-5G/LIC expression vector(E. coli/S. japonicium) encoding glutathione S-transferase gene, complete cds |
| 2832 | 0.78% | TAACTGAACGAAGTACACTGA | TCAGTGTACTTCGTTCAGTTA | 90.48% | gnl|uv|NGB01107.1:1-36 Oxford Nanopore Technologies Ligation Sequencing Kit (SQK-LSK114) Ligation Adaptor Y Top |
| 2356 | 0.65% | GTAACTGAACGAAGCACAACA | TGTTGTGCTTCGTTCAGTTAC | 80.95% | Oxford nanopore Native Adapter (NA), bottom strand |
| 2258 | 0.62% | CCTCCTCCTCCTCCTCCTCCA | TGGAGGAGGAGGAGGAGGAGG | 80.95% | gnl|uv|FJ750577.1:368-2560 Cre-lox Univector acceptor vector pCR701 |
| 2233 | 0.62% | TAACTGAACGAAGCATACTGA | TCAGTATGCTTCGTTCAGTTA | 80.95% | Oxford nanopore Native Adapter (NA), bottom strand |
| 2068 | 0.57% | AGGAGGAGGAGGAGGAGGAGG | CCTCCTCCTCCTCCTCCTCCT | 71.43% | gnl|uv|M97937.1:846-1007 Plasmid pGEX-5G/LIC expression vector(E. coli/S. japonicium) encoding glutathione S-transferase gene, complete cds |
| 1843 | 0.51% | TAACTGAACGAAGTATACTGA | TCAGTATACTTCGTTCAGTTA | 85.71% | gnl|uv|NGB01107.1:1-36 Oxford Nanopore Technologies Ligation Sequencing Kit (SQK-LSK114) Ligation Adaptor Y Top |
| 1260 | 0.35% | TAACTGAACGAAGCATACCGA | TCGGTATGCTTCGTTCAGTTA | 85.71% | gnl|uv|JX560321.2:370-1372 Cloning vector pSEVA111 |
| 1164 | 0.32% | GTAACTGAACGAAGCATAACA | TGTTATGCTTCGTTCAGTTAC | 85.71% | Oxford nanopore Native Adapter (NA), bottom strand |
| 1076 | 0.30% | TAACTGAACGAAGTAATAACA | TGTTATTACTTCGTTCAGTTA | 85.71% | gnl|uv|NGB01098.1:1-61 Oxford Nanopore Technologies Sequencing Adapter Y_top |
| 1042 | 0.29% | CGCCTCCTCCTCCTCCTCCTC | GAGGAGGAGGAGGAGGAGGCG | 76.19% | gnl|uv|M97937.1:846-1007 Plasmid pGEX-5G/LIC expression vector(E. coli/S. japonicium) encoding glutathione S-transferase gene, complete cds |
| 999 | 0.28% | TAACTGGAACGAAGTACAACA | TGTTGTACTTCGTTCCAGTTA | 80.95% | Oxford nanopore Native Adapter (NA), bottom strand |
| 976 | 0.27% | GCAACTGAACGAAGTACAACA | TGTTGTACTTCGTTCAGTTGC | 80.95% | Oxford nanopore Native Adapter (NA), bottom strand |
| 940 | 0.26% | AACTGAACGAAGTAATACTGA | TCAGTATTACTTCGTTCAGTT | 71.43% | gnl|uv|NGB01098.1:1-61 Oxford Nanopore Technologies Sequencing Adapter Y_top |
| 888 | 0.24% | TAACTGAACGAAGCACAATGA | TCATTGTGCTTCGTTCAGTTA | 85.71% | gnl|uv|NGB01107.1:1-36 Oxford Nanopore Technologies Ligation Sequencing Kit (SQK-LSK114) Ligation Adaptor Y Top |
| 883 | 0.24% | CTCCTCCTCCTCCTCCTCCAC | GTGGAGGAGGAGGAGGAGGAG | 71.43% | gnl|uv|M97937.1:846-1007 Plasmid pGEX-5G/LIC expression vector(E. coli/S. japonicium) encoding glutathione S-transferase gene, complete cds |
| 852 | 0.23% | CACCTCCTCCTCCTCCTCCTC | GAGGAGGAGGAGGAGGAGGTG | 76.19% | gnl|uv|M97937.1:846-1007 Plasmid pGEX-5G/LIC expression vector(E. coli/S. japonicium) encoding glutathione S-transferase gene, complete cds |
| 849 | 0.23% | CTCCTCCTCCTCCTCCTCCGC | GCGGAGGAGGAGGAGGAGGAG | 80.95% | gnl|uv|NGB00972.1:1-45 Pacific Biosciences Blunt Adapter |
| 822 | 0.23% | TAACTGAACGAAGTATACCGA | TCGGTATACTTCGTTCAGTTA | 85.71% | gnl|uv|NGB01107.1:1-36 Oxford Nanopore Technologies Ligation Sequencing Kit (SQK-LSK114) Ligation Adaptor Y Top |
| 770 | 0.21% | CTCCTCCTCCTCCTCCGCCTC | GAGGCGGAGGAGGAGGAGGAG | 80.95% | gnl|uv|FJ750577.1:368-2560 Cre-lox Univector acceptor vector pCR701 |
| 745 | 0.21% | AACTGAACGAAGTACAATTGA | TCAATTGTACTTCGTTCAGTT | 90.48% | gnl|uv|NGB01098.1:1-61 Oxford Nanopore Technologies Sequencing Adapter Y_top |
| 742 | 0.20% | CTCCGCCTCCTCCTCCTCCTC | GAGGAGGAGGAGGAGGCGGAG | 80.95% | gnl|uv|FJ750577.1:368-2560 Cre-lox Univector acceptor vector pCR701 |
| 739 | 0.20% | GTAACTGAACGAAGTATAACA | TGTTATACTTCGTTCAGTTAC | 80.95% | Oxford nanopore Native Adapter (NA), bottom strand |
| 719 | 0.20% | TAACTGAACGAAGCACACTGA | TCAGTGTGCTTCGTTCAGTTA | 85.71% | gnl|uv|NGB01107.1:1-36 Oxford Nanopore Technologies Ligation Sequencing Kit (SQK-LSK114) Ligation Adaptor Y Top |
| 709 | 0.20% | CTCCTCCTCCTCCGCCTCCTC | GAGGAGGCGGAGGAGGAGGAG | 80.95% | gnl|uv|M28248.1:1-1709 Retroviral vector pLXSN |
| 709 | 0.20% | CTCCTCCTCCACCTCCTCCTC | GAGGAGGAGGTGGAGGAGGAG | 71.43% | gnl|uv|JN204911.1:1-169 Biobrick cloning vector BBa_96047 |
| 702 | 0.19% | CTCCTCCGCCTCCTCCTCCTC | GAGGAGGAGGAGGCGGAGGAG | 85.71% | gnl|uv|M28248.1:1-1709 Retroviral vector pLXSN |
| 697 | 0.19% | CTCCTCCTCCTCCACCTCCTC | GAGGAGGTGGAGGAGGAGGAG | 80.95% | gnl|uv|JN204911.1:1-169 Biobrick cloning vector BBa_96047 |
| 693 | 0.19% | CTCCACCTCCTCCTCCTCCTC | GAGGAGGAGGAGGAGGTGGAG | 76.19% | gnl|uv|M97937.1:846-1007 Plasmid pGEX-5G/LIC expression vector(E. coli/S. japonicium) encoding glutathione S-transferase gene, complete cds |
| 662 | 0.18% | CTCCTCCTCCTCCTCCACCTC | GAGGTGGAGGAGGAGGAGGAG | 71.43% | gnl|uv|FJ750577.1:368-2560 Cre-lox Univector acceptor vector pCR701 |
| 659 | 0.18% | GTAACTGAACGAAGTACATCA | TGATGTACTTCGTTCAGTTAC | 95.24% | gnl|uv|NGB01098.1:1-61 Oxford Nanopore Technologies Sequencing Adapter Y_top |
| 649 | 0.18% | CTCCTCCTCCGCCTCCTCCTC | GAGGAGGAGGCGGAGGAGGAG | 76.19% | gnl|uv|M28248.1:1-1709 Retroviral vector pLXSN |
| 639 | 0.18% | CTCCTCCACCTCCTCCTCCTC | GAGGAGGAGGAGGTGGAGGAG | 66.67% | gnl|uv|M97937.1:846-1007 Plasmid pGEX-5G/LIC expression vector(E. coli/S. japonicium) encoding glutathione S-transferase gene, complete cds |
| 624 | 0.17% | TAACTGAACGAAGTACACCGA | TCGGTGTACTTCGTTCAGTTA | 90.48% | gnl|uv|NGB01107.1:1-36 Oxford Nanopore Technologies Ligation Sequencing Kit (SQK-LSK114) Ligation Adaptor Y Top |
| 603 | 0.17% | CCTCCTCCTCCTCCTCCTCCG | CGGAGGAGGAGGAGGAGGAGG | 80.95% | gnl|uv|NGB00972.1:1-45 Pacific Biosciences Blunt Adapter |
| 584 | 0.16% | ATCCTCCTCCTCCTCCTCCTC | GAGGAGGAGGAGGAGGAGGAT | 71.43% | gnl|uv|M97937.1:846-1007 Plasmid pGEX-5G/LIC expression vector(E. coli/S. japonicium) encoding glutathione S-transferase gene, complete cds |
| 570 | 0.16% | GATGGAGGAGGAGGAGGAGGA | TCCTCCTCCTCCTCCTCCATC | 71.43% | gnl|uv|M97937.1:846-1007 Plasmid pGEX-5G/LIC expression vector(E. coli/S. japonicium) encoding glutathione S-transferase gene, complete cds |
| 556 | 0.15% | GAGGATGGAGGAGGAGGAGGA | TCCTCCTCCTCCTCCATCCTC | 71.43% | gnl|uv|M97937.1:846-1007 Plasmid pGEX-5G/LIC expression vector(E. coli/S. japonicium) encoding glutathione S-transferase gene, complete cds |
| 523 | 0.14% | TAACTGAACGAAGTACAACGA | TCGTTGTACTTCGTTCAGTTA | 90.48% | gnl|uv|NGB01107.1:1-36 Oxford Nanopore Technologies Ligation Sequencing Kit (SQK-LSK114) Ligation Adaptor Y Top |
| 517 | 0.14% | GTAACTGAACGAAGCATACCA | TGGTATGCTTCGTTCAGTTAC | 85.71% | Oxford nanopore Native Adapter (NA), bottom strand |
| 508 | 0.14% | CAACTGAACGAAGTACAATGA | TCATTGTACTTCGTTCAGTTG | 85.71% | gnl|uv|NGB01107.1:1-36 Oxford Nanopore Technologies Ligation Sequencing Kit (SQK-LSK114) Ligation Adaptor Y Top |
| 506 | 0.14% | AACTGAACGAAGTACAACAGA | TCTGTTGTACTTCGTTCAGTT | 76.19% | Oxford nanopore Native Adapter (NA), bottom strand |
| 500 | 0.14% | AACTGGAACGAAGTACAATGA | TCATTGTACTTCGTTCCAGTT | 85.71% | gnl|uv|NGB01107.1:1-36 Oxford Nanopore Technologies Ligation Sequencing Kit (SQK-LSK114) Ligation Adaptor Y Top |
| 500 | 0.14% | AACTGAACGAAGTATTACTGA | TCAGTAATACTTCGTTCAGTT | 71.43% | gnl|uv|NGB01098.1:1-61 Oxford Nanopore Technologies Sequencing Adapter Y_top |
| 499 | 0.14% | CGTAACTGAACGAAGTACTGA | TCAGTACTTCGTTCAGTTACG | 90.48% | Oxford nanopore Native Adapter (NA), bottom strand |
| 490 | 0.14% | GAGGAGGAGGAGGAGGATGGA | TCCATCCTCCTCCTCCTCCTC | 80.95% | gnl|uv|M97937.1:846-1007 Plasmid pGEX-5G/LIC expression vector(E. coli/S. japonicium) encoding glutathione S-transferase gene, complete cds |
| 485 | 0.13% | ACGTAACTGAACGAAGTATGA | TCATACTTCGTTCAGTTACGT | 85.71% | Oxford nanopore Native Adapter (NA), bottom strand |
| 471 | 0.13% | TAACTGAACGAAGTACATCGA | TCGATGTACTTCGTTCAGTTA | 90.48% | gnl|uv|NGB01107.1:1-36 Oxford Nanopore Technologies Ligation Sequencing Kit (SQK-LSK114) Ligation Adaptor Y Top |
| 470 | 0.13% | GAGGAGGATGGAGGAGGAGGA | TCCTCCTCCTCCATCCTCCTC | 80.95% | gnl|uv|U59231.1:8434-10310-48 Cloning vector cLHYGpk |
| 453 | 0.12% | GCCTCCTCCTCCTCCTCCTCC | GGAGGAGGAGGAGGAGGAGGC | 76.19% | gnl|uv|M97937.1:846-1007 Plasmid pGEX-5G/LIC expression vector(E. coli/S. japonicium) encoding glutathione S-transferase gene, complete cds |
| 452 | 0.12% | GAGGAGGAGGATGGAGGAGGA | TCCTCCTCCATCCTCCTCCTC | 85.71% | gnl|uv|U13843.1:1887-9923 pBPV cloning vector |
| 449 | 0.12% | GAGGAGGAGGAGGATGGAGGA | TCCTCCATCCTCCTCCTCCTC | 71.43% | gnl|uv|M97937.1:846-1007 Plasmid pGEX-5G/LIC expression vector(E. coli/S. japonicium) encoding glutathione S-transferase gene, complete cds |
| 445 | 0.12% | GTAACTGAACGAAGTACACGA | TCGTGTACTTCGTTCAGTTAC | 95.24% | gnl|uv|NGB01107.1:1-36 Oxford Nanopore Technologies Ligation Sequencing Kit (SQK-LSK114) Ligation Adaptor Y Top |
| 444 | 0.12% | CATTGTACTTCGTTCAGTTAC | GTAACTGAACGAAGTACAATG | 90.48% | gnl|uv|NGB01098.1:1-61 Oxford Nanopore Technologies Sequencing Adapter Y_top |
| 425 | 0.12% | AACTGAACGAAGTAATACCGA | TCGGTATTACTTCGTTCAGTT | 71.43% | gnl|uv|NGB01098.1:1-61 Oxford Nanopore Technologies Sequencing Adapter Y_top |
| 402 | 0.11% | GAGGAGGAGGAGGAGGATAAA | TTTATCCTCCTCCTCCTCCTC | 76.19% | gnl|uv|U13843.1:1887-9923 pBPV cloning vector |
| 392 | 0.11% | GTAACCGAACGAAGTACAACA | TGTTGTACTTCGTTCGGTTAC | 80.95% | Oxford nanopore Native Adapter (NA), bottom strand |
| 382 | 0.11% | AACTGAACGAAGTAATAATGA | TCATTATTACTTCGTTCAGTT | 76.19% | gnl|uv|NGB01098.1:1-61 Oxford Nanopore Technologies Sequencing Adapter Y_top |
| 381 | 0.11% | AACTGAACGAAGTATTACCGA | TCGGTAATACTTCGTTCAGTT | 71.43% | gnl|uv|NGB01098.1:1-61 Oxford Nanopore Technologies Sequencing Adapter Y_top |
| 377 | 0.10% | GTAACTGAACGAAGTATACCA | TGGTATACTTCGTTCAGTTAC | 80.95% | Oxford nanopore Native Adapter (NA), bottom strand |
| 371 | 0.10% | ACGTAACTGAACGAAGTAACA | TGTTACTTCGTTCAGTTACGT | 95.24% | Oxford nanopore Native Adapter (NA), bottom strand |
| 368 | 0.10% | ACAACTGAACGAAGTACAACA | TGTTGTACTTCGTTCAGTTGT | 76.19% | Oxford nanopore Native Adapter (NA), bottom strand |
| 366 | 0.10% | GGAGGAGGAGGAGGAGGCGGA | TCCGCCTCCTCCTCCTCCTCC | 80.95% | gnl|uv|FJ750577.1:368-2560 Cre-lox Univector acceptor vector pCR701 |
Nanopore time series
Base counts over time
Read counts over time
Active channels over time
Quality distribution over time
Per channel base yield versus quality
translocation speeds
Duration information not available.Chimeric read splitting
Dorado performs read splitting when it finds adapter sequences in the middle of the signal. The read is split and the original signal uuid is saved in the 'pi' tag.
No 'pi' tags were found.